Journal: Neuron

Article Title: TDP-43 seeding induces cytoplasmic aggregation heterogeneity and nuclear loss of function of TDP-43.

doi: 10.1016/j.neuron.2025.03.004

Figure Lengend Snippet: Figure 3. Fibril-induced nuclear depletion and loss of function of TDP-43 in human cells (A) Experimental outline of TDP-43mNLS-Clover U2OS cells 2 days post-seed exposure (50 nM) and further analyzed by immunostaining, RT-PCR, and RNA-seq. (B) Immunostaining of total TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in TDP-43mNLS-Clover U2OS cells. Red arrows indicate TDP-43mNLS- Clover inclusions. Scale bar overview: 100 mm; close up: 20 mm. (C) Mean nuclear TDP-43 intensity in cells with full (red) and partial (orange) TDP-43mNLS-Clover aggregation or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (D) Experimental outline of naive U2OS cells 2 days post-seed exposure (100 nM) and further analyzed by immunostaining and RT-PCR. (E) Immunostaining of endogenous TDP-43 (white), phospho-TDP-43 (yellow), and DAPI (blue) in naive U2OS cells. Red arrows indicate TDP-43 inclusions. Scale bar overview: 100 mm; close up: 20 mm. (F) Mean nuclear TDP-43 intensity in cells with aggregates (red) or without aggregates (green). Data points are nuclei from 3 experiments. Mean ± SD. Unpaired t test (****p < 0.0001). (G) RT-PCR analysis of de novo cryptic RNA transcripts in naive or TDP-43mNLS-Clover cells 2 days post-seed (or control buffer) exposure. GAPDH transcript was used as control. (H) TDP-43mNLS-Clover U2OS cells with and without aggregates, respectively, isolated using image-based FACS 2 days post-seed exposure, followed by RNA- seq to identify RNA splicing changes (left). Visualization of cryptic exons located in UNC13A, HDGFL2, GPSM2, ATG4B, EPB41L4A, PFKP, and AGRN genes. RNA-seq reads from cells without aggregates (top, blue) or with aggregates (bottom, purple) are aligned to the hg38 genome (reads from 3 experiments). Cryptic exons (red arrows) are specifically detected in cells with aggregates. Gene annotations are shown below in blue, labeling exons (thick) and introns (thin) (right). See also Figure S5 and Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER GAPDH Reverse: GAAGATGGTGATGGGATTTC IDT N/A Recombinant DNA pJ411_His-TDP43_LCD Addgene 98669 pLenti_CMV_TDP-43WT-Clover This paper N/A Software and algorithms FIJI (ImageJ) NIH https://imagej.net/software/fiji/downloads GraphPad prism GraphPad https://www.graphpad.com/ scientific-software/prism/ Harmony High-content imaging and analysis software PerkinElmer N/A NIS Elements Advanced Research software Nikon https://www.microscope.healthcare. nikon.com/products/software/niselements/nis-elements-advanced-research MATLAB MathWorks https://nl.mathworks.com/products/ matlab.html Zen Black 2.3 SP1 ZEISS https://www.micro-shop.zeiss.com/en/ us/softwarefinder/software-categories/ zen-black/zen-black-system/ Symphotime software PicoQuant https://www.picoquant.com/products/ category/software SnapGene Snapgene https://www.snapgene.com/ BioRender BioRender https://biorender.com/ Inkscape Inkscape https://inkscape.org/ Other 96-well imaging plate (PhenoPlate) PerkinElmer 6055802 Glass-bottom 8-well chamber slides Ibidi 80827 HisTrap HP column Cytiva 17524801 Superdex-200 16-600 size-exclusion column Cytiva 28989335 Äkta Pure protein purification system Cytiva N/A TEM copper grid Ted Pella Inc. 01753-F Microplate Shaker/Incubator PV-PVC Provocell N/A Branson 450 Digital Sonifier – Probe sonicator Branson N/A Bioruptor pico Diagenode N/A JEM 1400 elecron microscope JEOL N/A FluoStar Omega plate reader BMG Labtech N/A Operetta CLS microscope PerkinElmer N/A Nikon A1R Eclipse TiE confocal microscope Nikon N/A Zeiss LSM 880 confocal microscope Zeiss N/A

Techniques: Immunostaining, Reverse Transcription Polymerase Chain Reaction, RNA Sequencing, Control, Isolation, Labeling

Journal: iScience

Article Title: Anti-fibrotic, muscle-promoting antibody-drug conjugates for the improvement and treatment of DMD

doi: 10.1016/j.isci.2025.112335

Figure Lengend Snippet:

Article Snippet: Primer: GAPDH Forward: TTGCCATCAACGACCCCTTCAT , Metabion (HyLabs) , N/A.

Techniques: Recombinant, Transfection, Enzyme-linked Immunosorbent Assay, Proliferation Assay, Software, Real-time Polymerase Chain Reaction, Microscopy